Transcript: Human NR_103795.1

Homo sapiens nuclear transcription factor, X-box binding like 1 (NFXL1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
NFXL1 (152518)
Length:
3903
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103795.1
NBCI Gene record:
NFXL1 (152518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245353 GGGCTATGACATGCCTAATTT pLKO_005 524 3UTR 100% 15.000 21.000 N NFXL1 n/a
2 TRCN0000245355 CAAGTATGTGAGCGTGAATTT pLKO_005 820 3UTR 100% 13.200 18.480 N NFXL1 n/a
3 TRCN0000016137 CCTAGTAGGTACTATTGCTAT pLKO.1 742 3UTR 100% 4.950 6.930 N NFXL1 n/a
4 TRCN0000245356 TACTAGAAAGGGCAGTATAAT pLKO_005 3141 3UTR 100% 15.000 10.500 N NFXL1 n/a
5 TRCN0000245352 GATGGAGATACACGTGAATTA pLKO_005 463 3UTR 100% 13.200 9.240 N NFXL1 n/a
6 TRCN0000245354 GTATCCAGAAGTGGGCTAAAG pLKO_005 617 3UTR 100% 10.800 7.560 N NFXL1 n/a
7 TRCN0000016134 CCATGTCAGAAATCAAAGTTT pLKO.1 1246 3UTR 100% 5.625 3.938 N NFXL1 n/a
8 TRCN0000016136 CCTATTCCTATGGAATGTCTT pLKO.1 1963 3UTR 100% 4.950 3.465 N NFXL1 n/a
9 TRCN0000016133 GCCAAGTATGTGAGCGTGAAT pLKO.1 818 3UTR 100% 4.950 3.465 N NFXL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.