Transcript: Human NR_103797.1

Homo sapiens SON DNA binding protein (SON), transcript variant c, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
SON (6651)
Length:
8467
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103797.1
NBCI Gene record:
SON (6651)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083723 CCCTAATAAGAAGCATGCTAA pLKO.1 7398 3UTR 100% 4.950 6.930 N SON n/a
2 TRCN0000083725 GCAGATTTAGTGAGACCGTTA pLKO.1 5246 3UTR 100% 4.050 5.670 N SON n/a
3 TRCN0000083726 GCCTACTACAACACTGGTGTT pLKO.1 805 3UTR 100% 4.050 5.670 N SON n/a
4 TRCN0000303921 ACACCATGGAGACCCATATAT pLKO_005 2211 3UTR 100% 15.000 10.500 N SON n/a
5 TRCN0000303984 ACAGCGCTGGAATCCTATAAT pLKO_005 2090 3UTR 100% 15.000 10.500 N SON n/a
6 TRCN0000307414 ACAGCGCTGGAATCCTATAAT pLKO_005 2090 3UTR 100% 15.000 10.500 N Son n/a
7 TRCN0000303922 AGATACAGAACTACGATATAA pLKO_005 274 3UTR 100% 15.000 10.500 N SON n/a
8 TRCN0000303863 AGGAGTGCCTCACGTAGATAG pLKO_005 7495 3UTR 100% 10.800 7.560 N SON n/a
9 TRCN0000083724 CGCTCTATGATGTCAGCTTAT pLKO.1 3221 3UTR 100% 10.800 7.560 N SON n/a
10 TRCN0000300022 CGCTCTATGATGTCAGCTTAT pLKO_005 3221 3UTR 100% 10.800 7.560 N SON n/a
11 TRCN0000083727 GCCAGAATCTTCAATTACGTT pLKO.1 3817 3UTR 100% 3.000 2.100 N SON n/a
12 TRCN0000102292 CGCTCTATGATGTCTTATGAA pLKO.1 3098 3UTR 100% 5.625 3.938 N Son n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103797.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.