Transcript: Human NR_103802.1

Homo sapiens EBP like (EBPL), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-13
Taxon:
Homo sapiens (human)
Gene:
EBPL (84650)
Length:
1097
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103802.1
NBCI Gene record:
EBPL (84650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049379 GCTGATGCAAGATGGGTTTAT pLKO.1 443 3UTR 100% 13.200 9.240 N EBPL n/a
2 TRCN0000049381 CGATGGCTTGATTGCTTCTTT pLKO.1 403 3UTR 100% 5.625 3.938 N EBPL n/a
3 TRCN0000049380 CCTCATTTATGCCATAGTCAA pLKO.1 529 3UTR 100% 4.950 3.465 N EBPL n/a
4 TRCN0000049382 CCAACCATTGTGTCTGTGGAA pLKO.1 470 3UTR 100% 2.640 1.848 N EBPL n/a
5 TRCN0000049378 CATTCCAGTCTACACTTTGTT pLKO.1 886 3UTR 100% 5.625 3.375 N EBPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.