Transcript: Human NR_104003.2

Homo sapiens dimethylglycine dehydrogenase (DMGDH), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
DMGDH (29958)
Length:
2402
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104003.2
NBCI Gene record:
DMGDH (29958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162002 GCAGTCAAAGGTGGATATGAT pLKO.1 968 3UTR 100% 5.625 7.875 N DMGDH n/a
2 TRCN0000026518 GCTCGGAGTATAAACAGGTTA pLKO.1 693 3UTR 100% 4.950 6.930 N DMGDH n/a
3 TRCN0000159126 GAGATGAACTGTGATACAAAT pLKO.1 1325 3UTR 100% 13.200 9.240 N DMGDH n/a
4 TRCN0000161334 GATCCTAATCGCTATGGCAAA pLKO.1 419 3UTR 100% 4.050 2.835 N DMGDH n/a
5 TRCN0000163122 GAGCTGACTGTTTCTCACCAA pLKO.1 875 3UTR 100% 2.640 1.848 N DMGDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104003.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.