Transcript: Human NR_104040.2

Homo sapiens secretion regulating guanine nucleotide exchange factor (SERGEF), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SERGEF (26297)
Length:
1536
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104040.2
NBCI Gene record:
SERGEF (26297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296425 CCATAAAGAGAAGGTTGTTTG pLKO_005 487 3UTR 100% 10.800 15.120 N SERGEF n/a
2 TRCN0000296482 CTTCGTCTCCGCATTGCTTAA pLKO_005 1014 3UTR 100% 10.800 15.120 N SERGEF n/a
3 TRCN0000033816 CAGAGCATAATTTGGCAATAA pLKO.1 1147 3UTR 100% 13.200 10.560 N SERGEF n/a
4 TRCN0000033815 GCTTGGTCACACAGAGGATAT pLKO.1 283 3UTR 100% 10.800 8.640 N SERGEF n/a
5 TRCN0000289967 GCTTGGTCACACAGAGGATAT pLKO_005 283 3UTR 100% 10.800 8.640 N SERGEF n/a
6 TRCN0000033814 GCACATTGTTTCCAGAATGAA pLKO.1 812 3UTR 100% 5.625 3.938 N SERGEF n/a
7 TRCN0000289895 GCACATTGTTTCCAGAATGAA pLKO_005 812 3UTR 100% 5.625 3.938 N SERGEF n/a
8 TRCN0000033817 GCAACTGAATGACTTCTGTAA pLKO.1 157 3UTR 100% 4.950 3.465 N SERGEF n/a
9 TRCN0000296424 CAGACCACTCAGCTTCATTAA pLKO_005 699 3UTR 100% 13.200 7.920 N SERGEF n/a
10 TRCN0000033818 CGAGGACACTGAATCTCAGAA pLKO.1 1388 3UTR 100% 4.950 2.970 N SERGEF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.