Transcript: Human NR_104220.1

Homo sapiens bestrophin 3 (BEST3), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
BEST3 (144453)
Length:
1610
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104220.1
NBCI Gene record:
BEST3 (144453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165648 GCGGTCAGAACAGTTTGGTTT pLKO.1 1096 3UTR 100% 4.950 6.930 N BEST3 n/a
2 TRCN0000164823 CATGAAACCCATTCTGCCTTC pLKO.1 219 3UTR 100% 2.250 3.150 N BEST3 n/a
3 TRCN0000165157 GAACTGGCATGAAACCCATTC pLKO.1 212 3UTR 100% 6.000 4.200 N BEST3 n/a
4 TRCN0000162761 CCTCAACTTCAATCAAGGAAA pLKO.1 322 3UTR 100% 4.950 3.465 N BEST3 n/a
5 TRCN0000162760 CGTTTGAATACTCTGCTTGAA pLKO.1 285 3UTR 100% 4.950 3.465 N BEST3 n/a
6 TRCN0000165298 GAAACCCATTCTGCCTTCAAG pLKO.1 222 3UTR 100% 4.950 3.465 N BEST3 n/a
7 TRCN0000163915 CCTCGTTTGAATACTCTGCTT pLKO.1 282 3UTR 100% 2.640 1.848 N BEST3 n/a
8 TRCN0000165608 GCATGAAACCCATTCTGCCTT pLKO.1 218 3UTR 100% 2.640 1.848 N BEST3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.