Transcript: Mouse NR_104338.1

Mus musculus small cell adhesion glycoprotein (Smagp), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2017-05-15
Taxon:
Mus musculus (mouse)
Gene:
Smagp (207818)
Length:
1152
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104338.1
NBCI Gene record:
Smagp (207818)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249934 CTCCCTAGTTGACGACCAATA pLKO_005 934 3UTR 100% 10.800 15.120 N Smagp n/a
2 TRCN0000249938 GAGTACTTCATCTAATGCTTC pLKO_005 629 3UTR 100% 4.050 3.240 N Smagp n/a
3 TRCN0000190523 GAGAGAAGGAAGAGTACTTCA pLKO.1 618 3UTR 100% 4.950 3.465 N Smagp n/a
4 TRCN0000189906 GCAGAGAGAAGGAAGAGTACT pLKO.1 615 3UTR 100% 4.950 3.465 N Smagp n/a
5 TRCN0000190398 CAGAGAGAAGGAAGAGTACTT pLKO.1 616 3UTR 100% 4.950 2.970 N Smagp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104338.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.