Transcript: Mouse NR_104415.1

Mus musculus fucose mutarotase (Fuom), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Fuom (69064)
Length:
2416
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104415.1
NBCI Gene record:
Fuom (69064)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177827 CGATATGGAAGCGTTATGAAT pLKO.1 328 3UTR 100% 5.625 7.875 N Fuom n/a
2 TRCN0000328151 CGATATGGAAGCGTTATGAAT pLKO_005 328 3UTR 100% 5.625 7.875 N Fuom n/a
3 TRCN0000181897 GAAGCGTTATGAATCCCTTCT pLKO.1 335 3UTR 100% 4.050 5.670 N Fuom n/a
4 TRCN0000182710 CAAGAAGGGAACTCTTGACCT pLKO.1 555 3UTR 100% 0.264 0.211 N Fuom n/a
5 TRCN0000328088 TGAAGCTAGAGAGATTTGAAT pLKO_005 385 3UTR 100% 5.625 3.938 N Fuom n/a
6 TRCN0000198677 CCTGATGAAGCTAGAGAGATT pLKO.1 380 3UTR 100% 4.950 3.465 N Fuom n/a
7 TRCN0000181597 GCGTTATGAATCCCTTCTTCT pLKO.1 338 3UTR 100% 4.950 3.465 N Fuom n/a
8 TRCN0000328152 GCGTTATGAATCCCTTCTTCT pLKO_005 338 3UTR 100% 4.950 3.465 N Fuom n/a
9 TRCN0000328153 GTCCTTGCTGATGCGAACTTC pLKO_005 135 3UTR 100% 4.950 3.465 N Fuom n/a
10 TRCN0000328154 TTGACCTCGGACCCTCATAGA pLKO_005 569 3UTR 100% 4.950 3.465 N Fuom n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104415.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.