Transcript: Human NR_110859.2

Homo sapiens erythroid differentiation regulatory factor 1 (EDRF1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
EDRF1 (26098)
Length:
3983
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110859.2
NBCI Gene record:
EDRF1 (26098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122332 CGCGACTCTTCTGGAAAGAAT pLKO.1 3742 3UTR 100% 5.625 7.875 N EDRF1 n/a
2 TRCN0000142936 CTTCCGCCAATTACATGCTTT pLKO.1 1620 3UTR 100% 4.950 6.930 N EDRF1 n/a
3 TRCN0000121579 CCAGAAGAAGGCTTGTATTAT pLKO.1 2903 3UTR 100% 15.000 10.500 N EDRF1 n/a
4 TRCN0000191999 GCTGATTCTCAAGTCATCAAA pLKO.1 2176 3UTR 100% 5.625 3.938 N Edrf1 n/a
5 TRCN0000141069 CGCATAGGAAGGACTCTCTTA pLKO.1 544 3UTR 100% 4.950 3.465 N EDRF1 n/a
6 TRCN0000141014 CGTCCAGTTCAGATCAGACAA pLKO.1 791 3UTR 100% 4.950 3.465 N EDRF1 n/a
7 TRCN0000144826 GCCAATTACATGCTTTCAGAA pLKO.1 1625 3UTR 100% 4.950 3.465 N EDRF1 n/a
8 TRCN0000142986 CCTAGTCTCAATCGAGAAGAA pLKO.1 3548 3UTR 100% 4.950 2.970 N EDRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110859.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.