Transcript: Human NR_111929.2

Homo sapiens family with sequence similarity 228 member B (FAM228B), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FAM228B (375190)
Length:
793
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111929.2
NBCI Gene record:
FAM228B (375190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_111929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144764 GAGGCAGCTATTCAATCAATA pLKO.1 325 3UTR 100% 13.200 9.240 N FAM228B n/a
2 TRCN0000139208 CTGTGCTATCAGGAGGGAAAT pLKO.1 407 3UTR 100% 10.800 7.560 N FAM228B n/a
3 TRCN0000139994 GAAAGAGAACCGCTGTGCTAT pLKO.1 395 3UTR 100% 4.950 2.970 N FAM228B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111929.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.