Transcript: Mouse NR_111938.1

Mus musculus post-GPI attachment to proteins 2 (Pgap2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2016-09-01
Taxon:
Mus musculus (mouse)
Gene:
Pgap2 (233575)
Length:
1620
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_111938.1
NBCI Gene record:
Pgap2 (233575)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_111938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262951 ACTTCCGGCACAACATGTATT pLKO_005 407 3UTR 100% 13.200 10.560 N Pgap2 n/a
2 TRCN0000262952 GGAACAAAGAGCTGCTAATAA pLKO_005 521 3UTR 100% 15.000 10.500 N Pgap2 n/a
3 TRCN0000173815 CGGGAACAAAGAGCTGCTAAT pLKO.1 519 3UTR 100% 10.800 7.560 N Pgap2 n/a
4 TRCN0000194557 GCTCTTCGTCATCAACTTCAT pLKO.1 360 3UTR 100% 4.950 3.465 N Pgap2 n/a
5 TRCN0000262949 TCCCTATCTCCACGTTCTCTC pLKO_005 612 3UTR 100% 4.050 2.835 N Pgap2 n/a
6 TRCN0000173445 CGTCATCAACTTCATCTCCTT pLKO.1 366 3UTR 100% 2.640 1.848 N Pgap2 n/a
7 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 1274 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_111938.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.