Transcript: Mouse NR_121571.1

Mus musculus phospholipase C, delta 1 (Plcd1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Plcd1 (18799)
Length:
2715
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_121571.1
NBCI Gene record:
Plcd1 (18799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_121571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222645 GCCGTCAGACAGCAGTTATTA pLKO.1 2175 3UTR 100% 15.000 21.000 N Plcd1 n/a
2 TRCN0000351808 GCCGTCAGACAGCAGTTATTA pLKO_005 2175 3UTR 100% 15.000 21.000 N Plcd1 n/a
3 TRCN0000076927 CCTCCTCTAAGAACGACTTTA pLKO.1 2295 3UTR 100% 13.200 9.240 N Plcd1 n/a
4 TRCN0000351809 CCTCCTCTAAGAACGACTTTA pLKO_005 2295 3UTR 100% 13.200 9.240 N Plcd1 n/a
5 TRCN0000076926 CTCCTCTAAGAACGACTTTAT pLKO.1 2296 3UTR 100% 13.200 9.240 N Plcd1 n/a
6 TRCN0000076924 GCCACTACTTAGTGTCTTCTT pLKO.1 1019 3UTR 100% 4.950 3.465 N Plcd1 n/a
7 TRCN0000351807 GCCACTACTTAGTGTCTTCTT pLKO_005 1019 3UTR 100% 4.950 3.465 N Plcd1 n/a
8 TRCN0000222646 GCGGAGCTTGAGGCCACTGAA pLKO.1 2518 3UTR 100% 0.000 0.000 N Plcd1 n/a
9 TRCN0000351727 GCGGAGCTTGAGGCCACTGAA pLKO_005 2518 3UTR 100% 0.000 0.000 N Plcd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_121571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.