Transcript: Mouse NR_121588.1

Mus musculus predicted gene 5087 (Gm5087), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Gm5087 (328354)
Length:
1921
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_121588.1
NBCI Gene record:
Gm5087 (328354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_121588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183476 GCAACCTGATTATGTGTATTT pLKO.1 1190 3UTR 100% 13.200 18.480 N Gm5087 n/a
2 TRCN0000416903 TCCAGGAACCTCGAATGATAA pLKO_005 342 3UTR 100% 13.200 10.560 N Gm5087 n/a
3 TRCN0000179040 CGTATGTTCCAAATCCAACTA pLKO.1 459 3UTR 100% 4.950 3.960 N Gm5087 n/a
4 TRCN0000420567 AGAAGATGATGGGACAATAAT pLKO_005 670 3UTR 100% 15.000 10.500 N Gm5087 n/a
5 TRCN0000183090 CCTTTGTTGATGCTCTTAAAT pLKO.1 1730 3UTR 100% 15.000 10.500 N Gm5087 n/a
6 TRCN0000216654 CTGCTCTGCAGAAGTTTATTG pLKO.1 436 3UTR 100% 13.200 9.240 N Gm5087 n/a
7 TRCN0000183091 CTGGTAAATATGAAGGATCTT pLKO.1 600 3UTR 100% 4.950 3.465 N Gm5087 n/a
8 TRCN0000215615 GAACAAGTTAACATAGAAGAT pLKO.1 656 3UTR 100% 4.950 3.465 N Gm5087 n/a
9 TRCN0000179356 GAGAGTATTCTGATGGTCATA pLKO.1 549 3UTR 100% 4.950 3.465 N Gm5087 n/a
10 TRCN0000180531 GCCTAGCAATTCTTGAGCATA pLKO.1 1249 3UTR 100% 4.950 3.465 N Gm5087 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_121588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.