Transcript: Human NR_123715.2

Homo sapiens diacylglycerol kinase eta (DGKH), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
DGKH (160851)
Length:
4518
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_123715.2
NBCI Gene record:
DGKH (160851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_123715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356223 CTTGGAACCCGGGAGTTATTA pLKO_005 2947 3UTR 100% 15.000 21.000 N DGKH n/a
2 TRCN0000356222 AGTCGGAGGTGTAATCATATT pLKO_005 4035 3UTR 100% 13.200 18.480 N DGKH n/a
3 TRCN0000231670 TTGGTGCCACGCCGTTTATTG pLKO_005 2764 3UTR 100% 13.200 18.480 N DGKH n/a
4 TRCN0000196535 GAGAAGTTATTGCCACTTAAT pLKO.1 4073 3UTR 100% 13.200 10.560 N DGKH n/a
5 TRCN0000231668 GTTGGACAGGTGGAGTATAAT pLKO_005 1680 3UTR 100% 15.000 10.500 N DGKH n/a
6 TRCN0000231669 ATTGCTGGGAGTTCGATTATC pLKO_005 2712 3UTR 100% 13.200 9.240 N DGKH n/a
7 TRCN0000001357 CAGTCGGAGGTGTAATCATAT pLKO.1 4034 3UTR 100% 13.200 9.240 N DGKH n/a
8 TRCN0000356224 GAGGTCCTCATTTAGGTTTAA pLKO_005 1424 3UTR 100% 13.200 9.240 N DGKH n/a
9 TRCN0000001358 CCAGTAAATGTTCAGTCCTAA pLKO.1 1952 3UTR 100% 4.950 3.465 N DGKH n/a
10 TRCN0000001359 CCCTGAATAAAGCCAACCCAA pLKO.1 3605 3UTR 100% 2.640 1.848 N DGKH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_123715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.