Transcript: Mouse NR_126074.1

Mus musculus centromere protein A (Cenpa), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Cenpa (12615)
Length:
1390
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126074.1
NBCI Gene record:
Cenpa (12615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_126074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434899 TCGCGACAGAGCTCCAGTGTA pLKO_005 207 3UTR 100% 1.650 2.310 N Cenpa n/a
2 TRCN0000431239 ATGCTGGTCGGGTCACGCTTT pLKO_005 495 3UTR 100% 1.350 1.890 N Cenpa n/a
3 TRCN0000093124 GCATGGTTGTTAGAGAAATAT pLKO.1 328 3UTR 100% 15.000 10.500 N Cenpa n/a
4 TRCN0000439919 CTAAGCTGCCAGTGGAATGTA pLKO_005 571 3UTR 100% 5.625 3.938 N Cenpa n/a
5 TRCN0000093127 GCGCAGAAGACAGAAATTCAT pLKO.1 242 3UTR 100% 5.625 3.938 N Cenpa n/a
6 TRCN0000093125 CATTCAGTTGACCAGGAGAAT pLKO.1 526 3UTR 100% 4.950 3.465 N Cenpa n/a
7 TRCN0000436849 GAGCACAGACCTCTTGTTCAG pLKO_005 293 3UTR 100% 4.050 2.835 N Cenpa n/a
8 TRCN0000093126 AGACAGAAATTCATGTGGCTT pLKO.1 249 3UTR 100% 2.640 1.848 N Cenpa n/a
9 TRCN0000093123 CGCCATATAAATGCCTGCCTT pLKO.1 976 3UTR 100% 2.640 1.848 N Cenpa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.