Transcript: Mouse NR_126537.1

Mus musculus chloride channel accessory 4C, pseudogene (Clca4c-ps), non-coding RNA.

Source:
NCBI, updated 2015-10-14
Taxon:
Mus musculus (mouse)
Gene:
Clca4c-ps (622139)
Length:
712
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_126537.1
NBCI Gene record:
Clca4c-ps (622139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_126537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270594 TGTACCTGCTTCAGATGTCAG pLKO_005 228 3UTR 100% 4.050 2.835 N Clca4c-ps n/a
2 TRCN0000270529 CAACAATAATTGAACGCATGA pLKO_005 327 3UTR 100% 4.050 2.430 N Clca4c-ps n/a
3 TRCN0000270592 GGTTATGAAGACATCATTATT pLKO_005 278 3UTR 100% 15.000 7.500 Y Clca4c-ps n/a
4 TRCN0000270591 TACAAGCATGCTGACATTAAA pLKO_005 482 3UTR 100% 15.000 7.500 Y Clca4c-ps n/a
5 TRCN0000270528 GTGACTAAAGCATCTACATAC pLKO_005 356 3UTR 100% 10.800 5.400 Y Clca4c-ps n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_126537.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.