Transcript: Human NR_130734.2

Homo sapiens LIM domain binding 2 (LDB2), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
LDB2 (9079)
Length:
766
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130734.2
NBCI Gene record:
LDB2 (9079)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021804 CGCCACATTAACCCTTTCATT pLKO.1 587 3UTR 100% 5.625 7.875 N LDB2 n/a
2 TRCN0000271810 AGCCAGAGTACCGAATCTATG pLKO_005 240 3UTR 100% 10.800 7.560 N Ldb2 n/a
3 TRCN0000021806 CCGAATCTATGAGATGAACAA pLKO.1 250 3UTR 100% 4.950 3.465 N LDB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.