Transcript: Human NR_130764.2

Homo sapiens sodium/potassium transporting ATPase interacting 3 (NKAIN3), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NKAIN3 (286183)
Length:
2076
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130764.2
NBCI Gene record:
NKAIN3 (286183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134058 CCTCGATACATAATGGTGTAT pLKO.1 395 3UTR 100% 0.495 0.693 N NKAIN3 n/a
2 TRCN0000418613 GAATAAGCAAGAATTAGTAAG pLKO_005 809 3UTR 100% 10.800 8.640 N NKAIN3 n/a
3 TRCN0000159761 GCAGTGCTCTTTGAGAATTTA pLKO.1 999 3UTR 100% 15.000 10.500 N NKAIN3 n/a
4 TRCN0000414173 CTCAAAGGACACCGATCTAAT pLKO_005 487 3UTR 100% 13.200 9.240 N NKAIN3 n/a
5 TRCN0000134734 GCCTGTTATGTGATCAGTATT pLKO.1 710 3UTR 100% 13.200 9.240 N NKAIN3 n/a
6 TRCN0000159469 CCAGATTCAACATCTTCCTAA pLKO.1 919 3UTR 100% 4.950 3.465 N NKAIN3 n/a
7 TRCN0000160427 CCTAAAGATTGCCATTGCTTT pLKO.1 1028 3UTR 100% 4.950 3.465 N NKAIN3 n/a
8 TRCN0000138547 CCTCTCTGAAGAAGCAGCATT pLKO.1 1560 3UTR 100% 4.950 3.465 N NKAIN3 n/a
9 TRCN0000160088 CAGATGCTGCAAATTATTGAA pLKO.1 791 3UTR 100% 5.625 3.375 N NKAIN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.