Transcript: Human NR_130790.1

Homo sapiens mitochondrial elongation factor 1 (MIEF1), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
MIEF1 (54471)
Length:
1904
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130790.1
NBCI Gene record:
MIEF1 (54471)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_130790.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275295 TAGTGGCTGGCTCCATCAATT pLKO_005 1417 3UTR 100% 13.200 10.560 N MIEF1 n/a
2 TRCN0000155647 CAGCCAGCTAACCAATGTCAT pLKO.1 1757 3UTR 100% 4.950 3.465 N MIEF1 n/a
3 TRCN0000275348 CAGCCAGCTAACCAATGTCAT pLKO_005 1757 3UTR 100% 4.950 3.465 N MIEF1 n/a
4 TRCN0000155976 CCAAAGACAGTCGCAGATACA pLKO.1 1386 3UTR 100% 4.950 3.465 N MIEF1 n/a
5 TRCN0000202232 CCATCATGAATGTCCCTGGTT pLKO.1 1279 3UTR 100% 2.640 1.848 N Mief1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130790.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.