Transcript: Mouse NR_130961.1

Mus musculus RIKEN cDNA B230354K17 gene (B230354K17Rik), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2015-03-01
Taxon:
Mus musculus (mouse)
Gene:
B230354K17Rik (105246278)
Length:
3953
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130961.1
NBCI Gene record:
B230354K17Rik (105246278)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_130961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194102 GCAGACAACTATTCTCCCTTT pLKO.1 1231 3UTR 100% 4.050 2.835 N B230354K17Rik n/a
2 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3458 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.