Transcript: Mouse NR_130970.1

Mus musculus predicted gene 14296 (Gm14296), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-05-24
Taxon:
Mus musculus (mouse)
Gene:
Gm14296 (102639598)
Length:
5178
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_130970.1
NBCI Gene record:
Gm14296 (102639598)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_130970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092271 GCATAGCCTTATTTGGAAATT pLKO.1 1552 3UTR 100% 13.200 6.600 Y LOC435223 n/a
2 TRCN0000231379 TCACAGCTATAGGTTACATTT pLKO_005 293 3UTR 100% 13.200 6.600 Y 0610010B08Rik n/a
3 TRCN0000234269 TCACAGCTATAGGTTACATTT pLKO_005 293 3UTR 100% 13.200 6.600 Y 9230108I15Rik n/a
4 TRCN0000242348 ACATACAATTGAAGACCATTT pLKO_005 321 3UTR 100% 10.800 5.400 Y Gm14393 n/a
5 TRCN0000243733 ATAGGAATCTCACAGCTATAG pLKO_005 284 3UTR 100% 10.800 5.400 Y Gm14322 n/a
6 TRCN0000239453 CATACAATTGAAGACCATTTC pLKO_005 322 3UTR 100% 10.800 5.400 Y Gm14288 n/a
7 TRCN0000112104 GCCTTACACACTGGAGGTATA pLKO.1 865 3UTR 100% 10.800 5.400 Y Gm14296 n/a
8 TRCN0000239782 TGTGATGCTAGAGACCTATAG pLKO_005 267 3UTR 100% 10.800 5.400 Y Gm6710 n/a
9 TRCN0000243741 ACTCAGGAAGAGTGGGCTTTG pLKO_005 214 3UTR 100% 6.000 3.000 Y Gm14411 n/a
10 TRCN0000092269 CGTCAGAATTTGAAGATTGTT pLKO.1 1495 3UTR 100% 5.625 2.813 Y LOC435223 n/a
11 TRCN0000112103 CACTGATTTATTGTGGTCTAT pLKO.1 1424 3UTR 100% 4.950 2.475 Y Gm14296 n/a
12 TRCN0000112102 CCAACAAACATAAAGCATCTA pLKO.1 1262 3UTR 100% 4.950 2.475 Y Gm14296 n/a
13 TRCN0000086848 CCCGATTTGTTAAATCTCAAA pLKO.1 2435 3UTR 100% 4.950 2.475 Y LOC434126 n/a
14 TRCN0000112100 CCTTGTGTCATCTCAACAGAA pLKO.1 2010 3UTR 100% 4.950 2.475 Y Gm14296 n/a
15 TRCN0000112101 CTTGGGATTATATCACAGTTA pLKO.1 1010 3UTR 100% 4.950 2.475 Y Gm14296 n/a
16 TRCN0000092272 GCCCGAGTTAGAAGTAGACAT pLKO.1 711 3UTR 100% 4.950 2.475 Y LOC435223 n/a
17 TRCN0000243742 CACCTATGATGACGTGCATGT pLKO_005 186 3UTR 100% 4.050 2.025 Y Gm14411 n/a
18 TRCN0000087265 CCTGATTATTATATGCCTCAA pLKO.1 772 3UTR 100% 4.050 2.025 Y LOC433358 n/a
19 TRCN0000095226 CATGTGAACTTCACTCAGGAA pLKO.1 202 3UTR 100% 2.640 1.320 Y Zfp950 n/a
20 TRCN0000086686 CCTCAAATAACTGGACCTGCT pLKO.1 385 3UTR 100% 2.160 1.080 Y LOC381471 n/a
21 TRCN0000087264 GCCTCAATTAACAGCAGTTAA pLKO.1 786 3UTR 100% 1.320 0.660 Y LOC433358 n/a
22 TRCN0000235325 GTGATGCTAGAGACCTATAAG pLKO_005 268 3UTR 100% 13.200 6.600 Y OTTMUSG00000016228 n/a
23 TRCN0000231378 TGTGATGCTAGAGACCTATAA pLKO_005 267 3UTR 100% 13.200 6.600 Y 0610010B08Rik n/a
24 TRCN0000092266 CCACCGACACATGGATTCCAA pLKO.1 3227 3UTR 100% 3.000 1.500 Y LOC435723 n/a
25 TRCN0000087011 ACTTCACTCGAGTGTCGAGTA pLKO.1 514 3UTR 100% 0.000 0.000 Y LOC382264 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_130970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.