Transcript: Mouse NR_131062.1

Mus musculus exosome component 10 (Exosc10), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2016-06-16
Taxon:
Mus musculus (mouse)
Gene:
Exosc10 (50912)
Length:
2788
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131062.1
NBCI Gene record:
Exosc10 (50912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_131062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305575 GTTCGGTGACGAGTATGATTT pLKO_005 206 3UTR 100% 13.200 18.480 N Exosc10 n/a
2 TRCN0000305576 TCGATACCAATGACGTGATAT pLKO_005 382 3UTR 100% 13.200 18.480 N Exosc10 n/a
3 TRCN0000123545 CGACAATTCTAACACACCATT pLKO.1 614 3UTR 100% 4.950 6.930 N Exosc10 n/a
4 TRCN0000305577 AGTATGAACTGGATCACTTTA pLKO_005 817 3UTR 100% 13.200 9.240 N Exosc10 n/a
5 TRCN0000123548 GTGGAATCAAACAAGCAATAT pLKO.1 1278 3UTR 100% 13.200 9.240 N Exosc10 n/a
6 TRCN0000332103 GTGGAATCAAACAAGCAATAT pLKO_005 1278 3UTR 100% 13.200 9.240 N Exosc10 n/a
7 TRCN0000123544 GCCGAGAGATTGGAGAATGAT pLKO.1 1836 3UTR 100% 5.625 3.938 N Exosc10 n/a
8 TRCN0000123546 CCGAAGTAAAGTGACTGAATT pLKO.1 338 3UTR 100% 0.000 0.000 N Exosc10 n/a
9 TRCN0000332104 CCGAAGTAAAGTGACTGAATT pLKO_005 338 3UTR 100% 0.000 0.000 N Exosc10 n/a
10 TRCN0000123547 CCCTCCAGATAACTACCAGAA pLKO.1 1886 3UTR 100% 4.050 2.430 N Exosc10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.