Transcript: Mouse NR_131787.2

Mus musculus RIKEN cDNA D130043K22 gene (D130043K22Rik), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
D130043K22Rik (210108)
Length:
5007
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_131787.2
NBCI Gene record:
D130043K22Rik (210108)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_131787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268077 TATGTCAATGTCACGGTTATG pLKO_005 1542 3UTR 100% 10.800 15.120 N D130043K22Rik n/a
2 TRCN0000268038 CGAAGGACCCTCAGGTTAAAT pLKO_005 3949 3UTR 100% 15.000 10.500 N D130043K22Rik n/a
3 TRCN0000268037 CCCAATAATTCCATTACTTTG pLKO_005 2481 3UTR 100% 10.800 7.560 N D130043K22Rik n/a
4 TRCN0000268078 GTATCTACCACTTCCGGTTAA pLKO_005 2347 3UTR 100% 10.800 7.560 N D130043K22Rik n/a
5 TRCN0000154797 GCAGCCAAAGTACAGATGATA pLKO.1 1654 3UTR 100% 5.625 3.938 N KIAA0319 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_131787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.