Transcript: Mouse NR_132309.1

Mus musculus predicted gene, 45928 (Gm45928), transcript variant 2, long non-coding RNA.

Source:
NCBI, updated 2017-03-15
Taxon:
Mus musculus (mouse)
Gene:
Gm45928 (105948585)
Length:
886
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_132309.1
NBCI Gene record:
Gm45928 (105948585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_132309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111342 CCTAGAGGTGTACCAAGTGTT pLKO.1 409 3UTR 100% 4.950 2.475 Y Pold4 n/a
2 TRCN0000111340 GCTCATTCCAACCTTGGAGAA pLKO.1 566 3UTR 100% 4.050 2.025 Y Pold4 n/a
3 TRCN0000111344 CCTGAAGACCCTCACTTCCAA pLKO.1 440 3UTR 100% 3.000 1.500 Y Pold4 n/a
4 TRCN0000111341 CCTGGCAGTATGGGCCTTGTA pLKO.1 330 3UTR 100% 1.650 0.825 Y Pold4 n/a
5 TRCN0000053209 TGAGGCAGTTTGACCTGGCCT pLKO.1 312 3UTR 100% 0.220 0.110 Y POLD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_132309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.