Transcript: Human NR_134234.2

Homo sapiens poly(ADP-ribose) polymerase family member 10 (PARP10), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
PARP10 (84875)
Length:
3360
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134234.2
NBCI Gene record:
PARP10 (84875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052947 CGAGCTGCTCACTCTCTACTT pLKO.1 173 3UTR 100% 4.950 3.465 N PARP10 n/a
2 TRCN0000174238 CGAGCTGCTCACTCTCTACTT pLKO.1 173 3UTR 100% 4.950 3.465 N PARP10 n/a
3 TRCN0000052946 CTCTACCATGAGGACCTTCTT pLKO.1 1479 3UTR 100% 4.950 3.465 N PARP10 n/a
4 TRCN0000052945 CTGGAGTTGTACCTGGAGAAT pLKO.1 666 3UTR 100% 4.950 3.465 N PARP10 n/a
5 TRCN0000052944 GCTCAGTTCCAGTGTGTCTTT pLKO.1 1713 3UTR 100% 4.950 3.465 N PARP10 n/a
6 TRCN0000052943 CCACCCTCTGGCCTCCTGCTT pLKO.1 3044 3UTR 100% 0.000 0.000 N PARP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.