Transcript: Human NR_134654.1

Homo sapiens uncharacterized LOC401261 (LOC401261), long non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
LOC401261 (401261)
Length:
2744
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134654.1
NBCI Gene record:
LOC401261 (401261)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_134654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168203 CCCGCTATATCCAAAGATCTA pLKO.1 1389 3UTR 100% 4.950 6.930 N LOC401261 n/a
2 TRCN0000167198 CCATGTAAGTATCTGTTGGTA pLKO.1 772 3UTR 100% 3.000 4.200 N LOC401261 n/a
3 TRCN0000167783 GACCATTTAATGAGACCTATT pLKO.1 991 3UTR 100% 10.800 8.640 N LOC401261 n/a
4 TRCN0000167149 CCACATACATGGAAAGTAAAT pLKO.1 886 3UTR 100% 13.200 9.240 N LOC401261 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1803 3UTR 100% 13.200 6.600 Y LIAS n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1854 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1854 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.