Transcript: Mouse NR_134926.1

Mus musculus opioid receptor-like 1 (Oprl1), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Oprl1 (18389)
Length:
2386
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_134926.1
NBCI Gene record:
Oprl1 (18389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_134926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444725 GCACAGAACTGGTGATCATAC pLKO_005 1197 3UTR 100% 10.800 7.560 N Oprl1 n/a
2 TRCN0000027807 CTATGCTTTCTTGGATGAGAA pLKO.1 579 3UTR 100% 4.950 3.465 N Oprl1 n/a
3 TRCN0000027784 CTGGTAGTTGTGGCTGTGTTT pLKO.1 421 3UTR 100% 4.950 3.465 N Oprl1 n/a
4 TRCN0000027792 CCCTGTATTTGCCATCTGCAT pLKO.1 261 3UTR 100% 2.640 1.848 N Oprl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_134926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.