Transcript: Human NR_135268.3

Homo sapiens chromosome 1 open reading frame 61 (C1orf61), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
C1orf61 (10485)
Length:
1279
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135268.3
NBCI Gene record:
C1orf61 (10485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263701 GGGCTGGATTCCCTCTGATAA pLKO_005 964 3UTR 100% 13.200 10.560 N C1orf61 n/a
2 TRCN0000263702 ATTCCATGATCTTGCTTATTC pLKO_005 819 3UTR 100% 13.200 9.240 N C1orf61 n/a
3 TRCN0000263703 CATGTCTAACCAAGATCTATA pLKO_005 861 3UTR 100% 13.200 9.240 N C1orf61 n/a
4 TRCN0000282769 GGCTATAGCACCAGCTCTTTG pLKO_005 883 3UTR 100% 10.800 7.560 N C1orf61 n/a
5 TRCN0000282768 TCTAGCAAGTTGAAGTCAAAC pLKO_005 1018 3UTR 100% 10.800 7.560 N C1orf61 n/a
6 TRCN0000167021 CTCTAGCAAGTTGAAGTCAAA pLKO.1 1017 3UTR 100% 4.950 3.465 N C1orf61 n/a
7 TRCN0000172451 CAGCACAAGCCATTGTGGAAT pLKO.1 705 3UTR 100% 0.495 0.297 N C1orf61 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.