Transcript: Human NR_135276.1

Homo sapiens BFSP2 antisense RNA 1 (BFSP2-AS1), transcript variant 1, long non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
BFSP2-AS1 (85003)
Length:
1542
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135276.1
NBCI Gene record:
BFSP2-AS1 (85003)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159082 GAAACCATCATTCTCAGCAAA pLKO.1 1262 3UTR 100% 4.950 2.475 Y ANKRD30B n/a
2 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 877 3UTR 100% 5.625 2.813 Y KLHL30 n/a
3 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 713 3UTR 100% 4.950 2.475 Y C16orf89 n/a
4 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 877 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.