Transcript: Human NR_135527.1

Homo sapiens discs large MAGUK scaffold protein 4 (DLG4), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
DLG4 (1742)
Length:
4243
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135527.1
NBCI Gene record:
DLG4 (1742)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235628 ACGATCATCGCTCAGTATAAA pLKO_005 2489 3UTR 100% 15.000 21.000 N DLG4 n/a
2 TRCN0000235626 CTGGACATCCTGGACTATTAT pLKO_005 1316 3UTR 100% 15.000 21.000 N DLG4 n/a
3 TRCN0000006111 GCATGAGTGGAAGGTCTAAAT pLKO.1 3984 3UTR 100% 13.200 18.480 N DLG4 n/a
4 TRCN0000235625 TGCATGAGTGGAAGGTCTAAA pLKO_005 3983 3UTR 100% 13.200 18.480 N DLG4 n/a
5 TRCN0000006112 CGTATGATGTTGTCTACCTAA pLKO.1 2034 3UTR 100% 4.950 6.930 N DLG4 n/a
6 TRCN0000235627 ACGAGAGTGGTCAAGGTTAAA pLKO_005 2818 3UTR 100% 13.200 9.240 N DLG4 n/a
7 TRCN0000321881 ACGAGAGTGGTCAAGGTTAAA pLKO_005 2818 3UTR 100% 13.200 9.240 N Dlg4 n/a
8 TRCN0000006113 CCTCTCAGAGAGTCAGAAATA pLKO.1 1345 3UTR 100% 13.200 9.240 N DLG4 n/a
9 TRCN0000235624 TATGATGTTGTCTACCTAAAG pLKO_005 2036 3UTR 100% 10.800 7.560 N DLG4 n/a
10 TRCN0000006115 GTCACGATCATCGCTCAGTAT pLKO.1 2486 3UTR 100% 4.950 3.465 N DLG4 n/a
11 TRCN0000161389 GCAGATTGGAGACAAGATCAT pLKO.1 1948 3UTR 100% 4.950 2.475 Y TAX1BP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.