Transcript: Human NR_135689.2

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 6 (ADAMTS6), non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ADAMTS6 (11174)
Length:
7460
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135689.2
NBCI Gene record:
ADAMTS6 (11174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051253 GCAGGCAGTATCTAAGTTATT pLKO.1 1094 3UTR 100% 13.200 18.480 N ADAMTS6 n/a
2 TRCN0000051256 CCTGACTTATCTTGAACACTA pLKO.1 962 3UTR 100% 4.950 6.930 N ADAMTS6 n/a
3 TRCN0000052380 GAGTGCAAAGATGTGAATAAA pLKO.1 4252 3UTR 100% 15.000 10.500 N ADAMTS6 n/a
4 TRCN0000051255 CCGCAAAGACATTGAACATTA pLKO.1 1658 3UTR 100% 13.200 9.240 N ADAMTS6 n/a
5 TRCN0000051257 GCTCTGTTCACATTGAAGTTA pLKO.1 3230 3UTR 100% 5.625 3.938 N ADAMTS6 n/a
6 TRCN0000052381 GCTGGACTACAGTGGTTGTTT pLKO.1 3819 3UTR 100% 5.625 3.938 N ADAMTS6 n/a
7 TRCN0000052379 CCAGGATTCAAGCATCGGATT pLKO.1 3937 3UTR 100% 4.050 2.835 N ADAMTS6 n/a
8 TRCN0000051254 GCAGCTCACATTACTGCGAAT pLKO.1 2156 3UTR 100% 4.050 2.835 N ADAMTS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.