Transcript: Human NR_135762.2

Homo sapiens ribosomal protein S9 (RPS9), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
RPS9 (6203)
Length:
890
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135762.2
NBCI Gene record:
RPS9 (6203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074797 GCCTGAAGATAGAGGATTTCT pLKO.1 357 3UTR 100% 5.625 7.875 N RPS9 n/a
2 TRCN0000307932 GCCTGAAGATAGAGGATTTCT pLKO_005 357 3UTR 100% 5.625 7.875 N RPS9 n/a
3 TRCN0000074795 GCAAGATGAAGCTGGATTACA pLKO.1 330 3UTR 100% 5.625 3.938 N RPS9 n/a
4 TRCN0000307931 GCAAGATGAAGCTGGATTACA pLKO_005 330 3UTR 100% 5.625 3.938 N RPS9 n/a
5 TRCN0000074796 CCTTCATTGTCCGCCTGGATT pLKO.1 670 3UTR 100% 4.950 3.465 N RPS9 n/a
6 TRCN0000307927 CCTTCATTGTCCGCCTGGATT pLKO_005 670 3UTR 100% 4.950 3.465 N RPS9 n/a
7 TRCN0000074794 GCTGAAGCTGATCGGCGAGTA pLKO.1 145 3UTR 100% 1.350 0.945 N RPS9 n/a
8 TRCN0000292008 GCTGAAGCTGATCGGCGAGTA pLKO_005 145 3UTR 100% 1.350 0.945 N RPS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.