Transcript: Human NR_135795.2

Homo sapiens syntrophin gamma 1 (SNTG1), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SNTG1 (54212)
Length:
6339
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135795.2
NBCI Gene record:
SNTG1 (54212)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148904 CCACGAGCAAAGCAAAGTATA pLKO.1 2448 3UTR 100% 13.200 18.480 N SNTG1 n/a
2 TRCN0000435518 GCTCATGTCTCTACAAGTTTC pLKO_005 1862 3UTR 100% 10.800 15.120 N SNTG1 n/a
3 TRCN0000433878 GCTTGTTTGGACCCTCTATTT pLKO_005 2384 3UTR 100% 13.200 10.560 N SNTG1 n/a
4 TRCN0000147410 GAAGCAAAGGAGTTGGAATTT pLKO.1 2309 3UTR 100% 13.200 9.240 N SNTG1 n/a
5 TRCN0000431329 GAGGAGCAGAACATAACATTC pLKO_005 1148 3UTR 100% 10.800 7.560 N SNTG1 n/a
6 TRCN0000428026 GTGCTAGAAAGTCATCTAATG pLKO_005 2132 3UTR 100% 10.800 7.560 N SNTG1 n/a
7 TRCN0000179836 CGGAACTTTCAGGACTACTTT pLKO.1 1205 3UTR 100% 5.625 3.938 N SNTG1 n/a
8 TRCN0000149141 GCTGTTCTTCACTGCATTCAT pLKO.1 2342 3UTR 100% 5.625 3.938 N SNTG1 n/a
9 TRCN0000180913 GCTGGAGAAGAAGTGACTCTA pLKO.1 1309 3UTR 100% 4.950 3.465 N SNTG1 n/a
10 TRCN0000149807 GAGCCTTTCTATTCTGGTGAA pLKO.1 1072 3UTR 100% 4.050 2.835 N SNTG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135795.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.