Transcript: Human NR_135904.2

Homo sapiens N-acylsphingosine amidohydrolase 2B (ASAH2B), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
ASAH2B (653308)
Length:
4998
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135904.2
NBCI Gene record:
ASAH2B (653308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256528 ACGCATTATCTGCTTACATTC pLKO_005 89 3UTR 100% 10.800 6.480 N ASAH2B n/a
2 TRCN0000049517 GCACGCATTATCTGCTTACAT pLKO.1 87 3UTR 100% 5.625 3.375 N ASAH2 n/a
3 TRCN0000256527 GGAAGTTGCTGAAGTTATATT pLKO_005 147 3UTR 100% 15.000 7.500 Y ASAH2B n/a
4 TRCN0000256526 CAACAGTGGAATGGCATATTC pLKO_005 332 3UTR 100% 13.200 6.600 Y ASAH2B n/a
5 TRCN0000256524 GGACTCCTGGGTCTGAGTAAT pLKO_005 310 3UTR 100% 13.200 6.600 Y ASAH2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.