Transcript: Human NR_136651.3

Homo sapiens jumonji domain containing 8 (JMJD8), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-28
Taxon:
Homo sapiens (human)
Gene:
JMJD8 (339123)
Length:
2022
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136651.3
NBCI Gene record:
JMJD8 (339123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359998 TCGTAAGCGCTGGTTCCTTTA pLKO_005 676 3UTR 100% 10.800 15.120 N JMJD8 n/a
2 TRCN0000173060 CAGAAGTGATCTACGGTCGTA pLKO.1 660 3UTR 100% 2.640 3.696 N JMJD8 n/a
3 TRCN0000166974 CAGAGATGAATGCGTCAATAA pLKO.1 1229 3UTR 100% 13.200 9.240 N JMJD8 n/a
4 TRCN0000360001 ACACCTACTCCTACCACAAAG pLKO_005 317 3UTR 100% 10.800 7.560 N JMJD8 n/a
5 TRCN0000359996 ACTTGCCCTTCCAGGAGTATG pLKO_005 341 3UTR 100% 10.800 7.560 N JMJD8 n/a
6 TRCN0000359999 ACAGGTTGCTGGCTTCGTTTG pLKO_005 266 3UTR 100% 6.000 4.200 N JMJD8 n/a
7 TRCN0000167284 CCAGGAACATAAACTATGTAT pLKO.1 1120 3UTR 100% 5.625 3.938 N JMJD8 n/a
8 TRCN0000172334 CACCTACTCCTACCACAAAGT pLKO.1 318 3UTR 100% 4.950 3.465 N JMJD8 n/a
9 TRCN0000172858 GTTCCTTTACCCACCTGAGAA pLKO.1 688 3UTR 100% 4.950 3.465 N JMJD8 n/a
10 TRCN0000172333 CAACACCTACTCCTACCACAA pLKO.1 315 3UTR 100% 4.050 2.835 N JMJD8 n/a
11 TRCN0000172422 CTCCAGCTTACAGCTTTGGAA pLKO.1 588 3UTR 100% 3.000 1.800 N JMJD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.