Transcript: Human NR_136720.1

Homo sapiens DEAD-box helicase 3 Y-linked (DDX3Y), transcript variant 9, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
DDX3Y (8653)
Length:
4739
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136720.1
NBCI Gene record:
DDX3Y (8653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_136720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338230 GACTTAGATAAACGGTCATTT pLKO_005 1733 3UTR 100% 13.200 9.240 N DDX3Y n/a
2 TRCN0000338174 TGGTATTGGCAATCGTGAAAG pLKO_005 463 3UTR 100% 10.800 7.560 N DDX3Y n/a
3 TRCN0000000020 GCCAGCAGTATTCTTCAGTAA pLKO.1 4575 3UTR 100% 4.950 3.465 N DDX3Y n/a
4 TRCN0000338229 GCCAGCAGTATTCTTCAGTAA pLKO_005 4575 3UTR 100% 4.950 3.465 N DDX3Y n/a
5 TRCN0000000024 GCGATATTGACATGGGAGAAA pLKO.1 693 3UTR 100% 4.950 3.465 N DDX3Y n/a
6 TRCN0000338170 GCGATATTGACATGGGAGAAA pLKO_005 693 3UTR 100% 4.950 3.465 N DDX3Y n/a
7 TRCN0000000022 TAGGTGCAACAGGGAGTGATT pLKO.1 1767 3UTR 100% 4.950 3.465 N DDX3Y n/a
8 TRCN0000000021 AGCGATATTGACATGGGAGAA pLKO.1 692 3UTR 100% 4.050 2.835 N DDX3Y n/a
9 TRCN0000338231 GCCGCAAACAATATCCAATAT pLKO_005 1164 3UTR 100% 13.200 7.920 N DDX3Y n/a
10 TRCN0000000023 AGGAGCAAGTACAGCGAGCAA pLKO.1 235 3UTR 100% 2.640 1.584 N DDX3Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.