Transcript: Mouse NR_136915.1

Mus musculus syntrophin, gamma 2 (Sntg2), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sntg2 (268534)
Length:
2397
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136915.1
NBCI Gene record:
Sntg2 (268534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_136915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112901 CGTCACCATCACTGTTGAGTA pLKO.1 583 3UTR 100% 4.950 6.930 N Sntg2 n/a
2 TRCN0000112900 GCGTTCAATCTCAACCAACAT pLKO.1 949 3UTR 100% 4.950 6.930 N Sntg2 n/a
3 TRCN0000112902 GTTGCGTTCAATCTCAACCAA pLKO.1 946 3UTR 100% 3.000 4.200 N Sntg2 n/a
4 TRCN0000112903 GCAGATTGAAACGAAGGAGCT pLKO.1 1604 3UTR 100% 2.160 3.024 N Sntg2 n/a
5 TRCN0000112904 CTACAGGTTAATGGCATTAAT pLKO.1 506 3UTR 100% 15.000 10.500 N Sntg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136915.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.