Transcript: Mouse NR_136923.1

Mus musculus tubulointerstitial nephritis antigen (Tinag), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Tinag (26944)
Length:
1717
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_136923.1
NBCI Gene record:
Tinag (26944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_136923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340229 CCTTGTTCATCCAGAATTAAT pLKO_005 540 3UTR 100% 15.000 21.000 N Tinag n/a
2 TRCN0000340231 TAGGATTCTTCGAGGAGTAAA pLKO_005 1431 3UTR 100% 13.200 18.480 N Tinag n/a
3 TRCN0000030654 CGCCTCAGAATTTGATCTCTT pLKO.1 888 3UTR 100% 4.950 3.960 N Tinag n/a
4 TRCN0000030657 GCCTTGTTCATCCAGAATTAA pLKO.1 539 3UTR 100% 15.000 10.500 N Tinag n/a
5 TRCN0000340287 ATGCATTCAAGTAACTCATTA pLKO_005 1540 3UTR 100% 13.200 9.240 N Tinag n/a
6 TRCN0000340286 GTCCCAACAGCTTCGAGAAAT pLKO_005 1095 3UTR 100% 13.200 9.240 N Tinag n/a
7 TRCN0000340234 TGATCCATAGCTATCACATTT pLKO_005 1509 3UTR 100% 13.200 9.240 N Tinag n/a
8 TRCN0000030658 CCAACAGGATTTACCAATGTT pLKO.1 1116 3UTR 100% 5.625 3.938 N Tinag n/a
9 TRCN0000030655 CCACATCAATAAAGGAGACTA pLKO.1 564 3UTR 100% 4.950 3.465 N Tinag n/a
10 TRCN0000030656 GCCATAATGCAAGTCCATGAA pLKO.1 1208 3UTR 100% 4.950 3.465 N Tinag n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_136923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.