Transcript: Mouse NR_137282.1

Mus musculus erythroid differentiation regulator 1 (Erdr1), transcript variant 1, non-coding, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Erdr1 (170942)
Length:
777
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_137282.1
NBCI Gene record:
Erdr1 (170942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_137282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246784 CAGTGATGTCACCCACGAAAG pLKO_005 565 3UTR 100% 6.000 8.400 N Erdr1 n/a
2 TRCN0000257550 CAAGATGTATGTGCCACCGAC pLKO_005 474 3UTR 100% 2.160 3.024 N Erdr1 n/a
3 TRCN0000246782 ACGGACTCCACAAGGTAGGAA pLKO_005 265 3UTR 100% 3.000 2.400 N Erdr1 n/a
4 TRCN0000246785 ACGAAAGCACACACGTAGAAG pLKO_005 579 3UTR 100% 4.950 3.465 N Erdr1 n/a
5 TRCN0000246783 TCAAGATGTCTCTGCCATCCC pLKO_005 612 3UTR 100% 2.160 1.296 N Erdr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_137282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.