Transcript: Human NR_138363.1

Homo sapiens RNA binding protein, mRNA processing factor 2 (RBPMS2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
RBPMS2 (348093)
Length:
1756
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138363.1
NBCI Gene record:
RBPMS2 (348093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242237 AGAATGCGCTGAACGGTATTC pLKO_005 255 3UTR 100% 10.800 15.120 N RBPMS2 n/a
2 TRCN0000168088 CGAGGAAGTGAGGTGTTTAAT pLKO.1 957 3UTR 100% 15.000 12.000 N RBPMS2 n/a
3 TRCN0000242239 TTTCATGTGCGTACCATTAAT pLKO_005 1422 3UTR 100% 15.000 12.000 N RBPMS2 n/a
4 TRCN0000167872 GCCCTGTCAGATAAGTTTAAT pLKO.1 1462 3UTR 100% 15.000 10.500 N RBPMS2 n/a
5 TRCN0000257188 GGCCTCCCTGTGGACATTAAA pLKO_005 110 3UTR 100% 15.000 10.500 N RBPMS2 n/a
6 TRCN0000168810 GAAGTACCGTCAGTTCTGTTA pLKO.1 610 3UTR 100% 4.950 3.465 N RBPMS2 n/a
7 TRCN0000340444 ATGAAGGGTCCCTGATCAAGC pLKO_005 171 3UTR 100% 4.050 2.835 N Rbpms2 n/a
8 TRCN0000242238 AGCTAATGGCAACTCCAAATC pLKO_005 348 3UTR 100% 10.800 6.480 N RBPMS2 n/a
9 TRCN0000168890 CCTTTGTGTCTGGCATTTGTT pLKO.1 1534 3UTR 100% 5.625 3.375 N RBPMS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138363.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.