Transcript: Human NR_144398.1

Homo sapiens unc-79 homolog, NALCN channel complex subunit (UNC79), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-09-30
Taxon:
Homo sapiens (human)
Gene:
UNC79 (57578)
Length:
1653
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144398.1
NBCI Gene record:
UNC79 (57578)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_144398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046328 GCTGTTGGACTTGTGGTGTTT pLKO.1 331 3UTR 100% 4.950 2.475 Y COX8C n/a
2 TRCN0000046332 GCTAGGCAACCTGAAGCAGTT pLKO.1 384 3UTR 100% 4.050 2.025 Y COX8C n/a
3 TRCN0000046330 ACGACCTTCTTAACACCAGCT pLKO.1 355 3UTR 100% 2.160 1.080 Y COX8C n/a
4 TRCN0000046329 GCAACCTGAAGCAGTTCAGAA pLKO.1 389 3UTR 100% 0.495 0.248 Y COX8C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144398.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.