Transcript: Mouse NR_144636.1

Mus musculus platelet derived growth factor receptor, alpha polypeptide (Pdgfra), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Pdgfra (18595)
Length:
1662
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_144636.1
NBCI Gene record:
Pdgfra (18595)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_144636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321928 GATGATCTGCAAGCATATTAA pLKO_005 1560 3UTR 100% 15.000 21.000 N Pdgfra n/a
2 TRCN0000322002 CGTTCAAGACCAGCGAGTTTA pLKO_005 809 3UTR 100% 13.200 10.560 N Pdgfra n/a
3 TRCN0000055003 GCCAGCTCTTATTACCCTCTA pLKO.1 287 3UTR 100% 4.050 3.240 N Pdgfra n/a
4 TRCN0000321999 AGTGGCCATTACACCATTATA pLKO_005 1384 3UTR 100% 15.000 10.500 N Pdgfra n/a
5 TRCN0000055005 CCTGGAGAAGTGAGAAACAAA pLKO.1 967 3UTR 100% 5.625 3.938 N Pdgfra n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_144636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.