Transcript: Human NR_145421.1

Homo sapiens long intergenic non-protein coding RNA 1931 (LINC01931), long non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
LINC01931 (150596)
Length:
1832
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145421.1
NBCI Gene record:
LINC01931 (150596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158796 GCTTAACATTCCTCAGTTATT pLKO.1 371 3UTR 100% 13.200 18.480 N LINC01931 n/a
2 TRCN0000160480 CTTGCTTAACATTCCTCAGTT pLKO.1 368 3UTR 100% 4.950 6.930 N LINC01931 n/a
3 TRCN0000137430 GCATCATGTTACACCCTACAA pLKO.1 285 3UTR 100% 4.950 3.960 N LINC01931 n/a
4 TRCN0000160481 CGTTAGACCTTTCTCTCTAAA pLKO.1 689 3UTR 100% 1.320 1.056 N LINC01931 n/a
5 TRCN0000158627 CCTCTGTTCTTAAGAGTTTAT pLKO.1 616 3UTR 100% 13.200 9.240 N LINC01931 n/a
6 TRCN0000158696 GCTGATTCATGCATTTCTATT pLKO.1 186 3UTR 100% 13.200 9.240 N LINC01931 n/a
7 TRCN0000162436 CTCTGTCTATGCAGGATTCTA pLKO.1 524 3UTR 100% 5.625 3.938 N LINC01931 n/a
8 TRCN0000160198 CACAAATTCCTCACTCATCTT pLKO.1 459 3UTR 100% 4.950 3.465 N LINC01931 n/a
9 TRCN0000160109 CAGAATAAAGTCTAGCTTCTT pLKO.1 404 3UTR 100% 4.950 3.465 N LINC01931 n/a
10 TRCN0000134084 CTGAATCTCTTGCTGATTCAT pLKO.1 175 3UTR 100% 0.563 0.394 N LINC01931 n/a
11 TRCN0000138601 CCTGAGCCTCAACTTTCTGAA pLKO.1 1130 3UTR 100% 4.950 2.970 N LINC01931 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.