Transcript: Mouse NR_145503.1

Mus musculus coenzyme Q4 (Coq4), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-02-12
Taxon:
Mus musculus (mouse)
Gene:
Coq4 (227683)
Length:
3026
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145503.1
NBCI Gene record:
Coq4 (227683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_145503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305919 ATTGGATCATACTGATCATTG pLKO_005 1900 3UTR 100% 10.800 8.640 N Coq4 n/a
2 TRCN0000098923 TGTGTCCTCAACATCTACTAT pLKO.1 1563 3UTR 100% 5.625 4.500 N Coq4 n/a
3 TRCN0000325287 TGTGTCCTCAACATCTACTAT pLKO_005 1563 3UTR 100% 5.625 4.500 N Coq4 n/a
4 TRCN0000098921 CGCCACGACATGGTTGCAGTT pLKO.1 991 3UTR 100% 1.350 1.080 N Coq4 n/a
5 TRCN0000311439 CAGGATGCCACACCCTGAAAT pLKO_005 1025 3UTR 100% 13.200 9.240 N Coq4 n/a
6 TRCN0000098924 ACACGCTTTGTGGACGATGAA pLKO.1 1196 3UTR 100% 4.950 3.465 N Coq4 n/a
7 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2926 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.