Transcript: Human NR_145960.2

Homo sapiens KIAA1755 (KIAA1755), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
KIAA1755 (85449)
Length:
4714
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_145960.2
NBCI Gene record:
KIAA1755 (85449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_145960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144285 CGAATCTGCAAAGGGAATAAA pLKO.1 2706 3UTR 100% 15.000 21.000 N KIAA1755 n/a
2 TRCN0000140817 GCATGGACCATTTGCCAAAGT pLKO.1 1868 3UTR 100% 4.950 3.960 N KIAA1755 n/a
3 TRCN0000140025 GCTGAGCTTCCTTCTGGATTT pLKO.1 367 3UTR 100% 10.800 7.560 N KIAA1755 n/a
4 TRCN0000141042 CCACGCAGAATTTGAGAACTT pLKO.1 1215 3UTR 100% 4.950 3.465 N KIAA1755 n/a
5 TRCN0000140544 GCCAAGAGTCACACACTTGAT pLKO.1 3990 3UTR 100% 4.950 3.465 N KIAA1755 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_145960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.