Transcript: Human NR_146178.1

Homo sapiens family with sequence similarity 157 member B (FAM157B), long non-coding RNA.

Source:
NCBI, updated 2018-05-20
Taxon:
Homo sapiens (human)
Gene:
FAM157B (100132403)
Length:
3690
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146178.1
NBCI Gene record:
FAM157B (100132403)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339045 AGAAACCAAGTGAGGACATTT pLKO_005 192 3UTR 100% 13.200 6.600 Y FAM157A n/a
2 TRCN0000082510 CCAGTCTCATGTTGAAGATTT pLKO.1 1940 3UTR 100% 13.200 6.600 Y LOC388573 n/a
3 TRCN0000337371 CTGCCCGAGGAAAGGTATTTC pLKO_005 1098 3UTR 100% 13.200 6.600 Y FAM157B n/a
4 TRCN0000337370 GAAACCAAGTGAGGACATTTA pLKO_005 193 3UTR 100% 13.200 6.600 Y FAM157B n/a
5 TRCN0000338978 GCTGCCCGAGGAAAGGTATTT pLKO_005 1097 3UTR 100% 13.200 6.600 Y FAM157A n/a
6 TRCN0000337372 TTCACCAGAGGATCCAGATTT pLKO_005 282 3UTR 100% 13.200 6.600 Y FAM157B n/a
7 TRCN0000338976 TCACCAGAGGATCCAGATTTC pLKO_005 283 3UTR 100% 10.800 5.400 Y FAM157A n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 635 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000337442 TTTGGTGTTCTTCATTGATTC pLKO_005 1291 3UTR 100% 10.800 5.400 Y FAM157B n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 635 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.