Transcript: Human NR_146439.1

Homo sapiens phosphoglucomutase 5 pseudogene 4 (PGM5P4), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
PGM5P4 (729468)
Length:
760
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146439.1
NBCI Gene record:
PGM5P4 (729468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049094 CAAGACTCATACCTATGCCTT pLKO.1 267 3UTR 100% 2.640 3.696 N LOC284964 n/a
2 TRCN0000049093 CAGAGAAGTTAAACGATTGAT pLKO.1 226 3UTR 100% 5.625 3.938 N LOC284964 n/a
3 TRCN0000049061 CGACTGATTATTGGACAGAAT pLKO.1 305 3UTR 100% 4.950 2.475 Y PGM5 n/a
4 TRCN0000200822 GTGAAGTTTAATGTTGCCAAT pLKO.1 437 3UTR 100% 4.050 2.025 Y Pgm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.