Transcript: Human NR_147095.2

Homo sapiens zinc finger DHHC-type containing 11B (ZDHHC11B), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZDHHC11B (653082)
Length:
5089
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147095.2
NBCI Gene record:
ZDHHC11B (653082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146918 CCACCTTTGAGTATCTCATTA pLKO.1 2135 3UTR 100% 13.200 6.600 Y ZDHHC11 n/a
2 TRCN0000147792 GAAAGATCCATACGTGCAAAT pLKO.1 2196 3UTR 100% 10.800 5.400 Y ZDHHC11 n/a
3 TRCN0000149871 GAAACAACAGAGCCCATGAAA pLKO.1 3107 3UTR 100% 5.625 2.813 Y ZDHHC11 n/a
4 TRCN0000130923 CCACCACTGCAAATGGATCAA pLKO.1 835 3UTR 100% 4.950 2.475 Y ZDHHC11 n/a
5 TRCN0000127619 CCACTGCAAATGGATCAACAA pLKO.1 838 3UTR 100% 4.950 2.475 Y ZDHHC11 n/a
6 TRCN0000149057 GCCGGAATTATTGGTTCTTCT pLKO.1 870 3UTR 100% 4.950 2.475 Y ZDHHC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147095.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.