Transcript: Human NR_147893.1

Homo sapiens BICD family like cargo adaptor 1 (BICDL1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-12-22
Taxon:
Homo sapiens (human)
Gene:
BICDL1 (92558)
Length:
3202
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147893.1
NBCI Gene record:
BICDL1 (92558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436798 TGCGGGAAGCAGATCGAGAAA pLKO_005 588 3UTR 100% 4.950 3.960 N BICDL1 n/a
2 TRCN0000155513 CCAAAGGCTATTGGATCAGCT pLKO.1 643 3UTR 100% 2.640 2.112 N BICDL1 n/a
3 TRCN0000423601 ATGAATTGAGAAGACGATTTG pLKO_005 474 3UTR 100% 10.800 7.560 N BICDL1 n/a
4 TRCN0000434553 GCCAAGTGCAGGATGGATATG pLKO_005 1502 3UTR 100% 10.800 7.560 N BICDL1 n/a
5 TRCN0000155216 GCATAAGGAGCTGACAGACAA pLKO.1 427 3UTR 100% 4.950 3.465 N BICDL1 n/a
6 TRCN0000156092 CGGAACAGAACCAAAGGCTAT pLKO.1 633 3UTR 100% 4.050 2.835 N BICDL1 n/a
7 TRCN0000156190 CTCATCAACCAACCAGCACAT pLKO.1 739 3UTR 100% 4.050 2.835 N BICDL1 n/a
8 TRCN0000155289 GAGAGTGATGTGAAGCAGCTA pLKO.1 536 3UTR 100% 2.640 1.848 N BICDL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.