Transcript: Human NR_148414.2

Homo sapiens cytochrome b5 reductase like (CYB5RL), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CYB5RL (606495)
Length:
856
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_148414.2
NBCI Gene record:
CYB5RL (606495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_148414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230552 GGATACTTTGAAGTGTTAATT pLKO_005 699 3UTR 100% 15.000 10.500 N CYB5RL n/a
2 TRCN0000164460 CCTGTGTGTTTGACCTCTATC pLKO.1 381 3UTR 100% 10.800 7.560 N CYB5RL n/a
3 TRCN0000163727 GCCAACGCAGAAGGATACTTT pLKO.1 687 3UTR 100% 5.625 3.938 N CYB5RL n/a
4 TRCN0000162552 CGCAGAAGGATACTTTGAAGT pLKO.1 692 3UTR 100% 4.950 3.465 N CYB5RL n/a
5 TRCN0000162236 CTGTGTGTTTGACCTCTATCA pLKO.1 382 3UTR 100% 4.950 3.465 N CYB5RL n/a
6 TRCN0000158927 GAAGGATACTTTGAAGTGTTA pLKO.1 696 3UTR 100% 4.950 3.465 N CYB5RL n/a
7 TRCN0000163578 GTGTTTGACCTCTATCACCGA pLKO.1 386 3UTR 100% 0.660 0.462 N CYB5RL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_148414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.